Group Abstract Group Abstract

Message Boards Message Boards

Recommended import and navigation methods for whole genome of plant?

Richard Frost, Frost Concepts
Posted 4 years ago

I'm interested in importing and navigating in Mathematica v12.2 desktop a recent GenBank whole genome of Ficus carica cultivar Dottato:

https://www.ncbi.nlm.nih.gov/genome/53047?genome_assembly_id=749845

I've come up empty handed in the Wolfram Guides for BiomolecularSequences, ifeSciencesAndMedicineDataAndComputation, and SequenceAlignmentAndComparison.

Recommendations are welcome!

BTW, an interesting article about this sequence and assembly can be found here:

https://onlinelibrary.wiley.com/doi/full/10.1111/tpj.14635

enter image description here
POSTED BY: Richard Frost
1 Reply
Sort By:

According to the web page, this has a GenBank ascension ID of CM019739.1. This can be used with a WFR function to import the sequence.

In[7]:= Short[
 genome = ResourceFunction["ImportFASTA"]["CM019739.1"], 10]

Out[7]//Short= {"CM019739.1 Ficus carica cultivar Dottato isolate GU2019 chromosome 1, whole genome shotgun sequence"},    
{"AGAGGACATCGAACAATATCAATCAATGTTCGTAGTTGCATCGCTTTCTTACTCTTTTTCCCACCAAATCTTCTAGTCATTAAGTGCCCTAATAATTTAACAAAGTTCAAAACATTTAAAACAAGAATAATGTAATGTCAAATTACAATTTTGAACATAAAAATATACTTATAACTTAATTGGGTCTTCAAAATCATCACCCGGTCGTTTCCTGGAGAATTAAAATACATGACTGAGTCATCCCACAGATCAATAACTGCCACGATCCAATGTTTCCCGTTGTTATATGGCATTAGAAACAACTTTCCTTTCAGTGCATTTGTTAAGATCCGTAAAATATTGTTGGCTTCCTCTCTACGGTAGACTTCGCGATCTA"...
"AATGGAGGTATACATGATGCAATGAACAAAAATATCATTTCAATTATGCACAGAACTTTACATTTTTTTTTTAATATTAGTTTGTCTTTAAAATCTGTTCTTCCAACTTTTTAAACTCGTTTATTTGTTCCATTGCCTCAACTTGGCTAATTTCTTCTTTCACTTATTGGGATCTAGAAATGCTAACAATTGGAACAAGTTAACCACGGCTAATTTCAGGAGAAAATTTGTTCTCAAAATAAATTATTAGGTTGTAGACGCAACTTGTGTTAGTGGGACAAATTTATGAGTTTCCCCTTATATGGGTAAGTCCTTGTGCGGGTCGAAGCCAATCTTGGACCCACATCCAGCAGCGCTAGCGAATGATACACACACACAC"}}

On a related note, an upcoming Wolfram blog (expected later this week) will cover usage of the Wolfram Function Repository functionality for genomic computation. It will of course have mention of ImportFASTA.
POSTED BY: Daniel Lichtblau
Reply to this discussion
Community posts can be styled and formatted using the Markdown syntax.
Tag limit exceeded
Note: Only the first five people you tag will receive an email notification; the other tagged names will appear as links to their profiles.
Reply Preview
Attachments
Remove
or Discard