You are mistaken about the meaning of "coding strand." In the bioinformatics community coding strand refers to the DNA sequence that matches the mRNA (except for having Ts instead of Us). This means the coding strand is what is produced by the process of transcription, and the coding strand (in RNA form) is the template the ribosome would use to make a polypeptide.

See here: coding strand from wikipedia

In essence the coding strand contains the actual codons, so when a ribosome "sees" TAC in the coding strand which is the template the ribosome is attached to, it will insert a tyrosine. The cell does not take the TAC from the coding strand and transcribe it to AUG as you suggest because the coding strand had already been made by transcription.

Think about it and see if you can realize your code is producing incorrect output.

It recently was uploaded to the WFR, actually! Here's the link.

Let's take your second-to-last sentence: In that case, a "TAC" on the template strand would code for an "AUG"/methionine on the mRNA/ribosome.

You have to remember there is chemical directionality to the DNA.

So, TAC on the template strand is really 5' - TAC - 3'

Which means, on the coding strand you would have: 3' - AUG - 5'

Since ribosomes always scan mRNA 5' to 3', the ribosome would actually "see" 5' - GUA - 3', so it would insert valine in the polypeptide.

Don't get frustrated. This is not intuitive stuff that naturally flows out of most textbooks. You are learning as you push through this.

The function can be used and called from the resource function repository: https://resources.wolframcloud.com/FunctionRepository/resources/DNAtoAminoAcid

Feel free to check it out!

-- you have earned Featured Contributor Badge Your exceptional post has been selected for our editorial column Staff Picks http://wolfr.am/StaffPicks and Your Profile is now distinguished by a Featured Contributor Badge and is displayed on the Featured Contributor Board. Thank you!

Samikshaa,

I always enjoy seeing Mathematica used for biology topics. Thank you for posting your work.

I do believe that the output of your code is, however, biologically incorrect.

Compare the list of amino acids from your first input cell to the list of amino acids returned by the built-in command BioSequenceTranslate:

ResourceFunction[
ResourceObject[<|"Name" -> "DNAtoAminoAcid", 
"ShortName" -> "DNAtoAminoAcid", 
"UUID" -> "67954e72-53c2-4527-a7c0-68dd2ba1497e", 
"ResourceType" -> "Function", "Version" -> "1.0.0", 
"Description" -> "Convert a given strand of DNA to a list of \
amino acids", 
"RepositoryLocation" -> URL[
"https://www.wolframcloud.com/obj/resourcesystem/api/1.0"], 
"SymbolName" -> "FunctionRepository`$\
093e0005691b471995f708959efa4269`DNAtoAminoAcid", 
"FunctionLocation" -> CloudObject[
"https://www.wolframcloud.com/obj/e7ed59a3-2a4e-4af8-b48c-\
a1d06c90942e"]|>, \
{ResourceSystemBase -> "https://www.wolframcloud.com/obj/\
resourcesystem/api/1.0"}]][\
"GTATACTGGTCATAGCATTGACTGGTCCATGTACTTACCGCT"]

Out[10]= {Entity["Chemical", "LMethionine"], 
Entity["Chemical", "LThreonine"], Entity["Chemical", "LSerine"], 
Entity["Chemical", "LIsoleucine"], Entity["Chemical", "LValine"], 
Entity["Chemical", "LThreonine"], 
Entity["Chemical", "LAsparticAcid"], 
Entity["Chemical", "LGlutamine"], Entity["Chemical", "LValine"], 
Entity["Chemical", "LHistidine"], 
Entity["Chemical", "LGlutamicAcid"], 
Entity["Chemical", "LTryptophan"], Entity["Chemical", "LArginine"]}

In[11]:= BioSequenceTranslate[
BioSequence["DNA", 
"GTATACTGGTCATAGCATTGACTGGTCCATGTACTTACCGCT"]]["SequenceString"]

Out[11]= "VYWS.H.LVHVLTA"

Compare Out[10] to Out[11], they are different.

The codon "GTA" codes for valine, not methionine.

Is this what you intended?

Are you adopting a non-standard genetic code? In the "standard" genetic code "TAC" codes for tyrosine, whereas ATG codes for methionine.

Well, once you have the BioSequence[], it isn't overly difficult to get the same result as your function:

Lookup[EntityValue[Entity["BioSequenceType", "Peptide"], 
                   EntityProperty["BioSequenceType", "AlphabetRules"]], 
       Characters[BioSequenceTranslate[BioSequenceComplement[
                  BioSequence["DNA", "AGTCGTAGTACGGAT"]]] @ "SequenceString"],
        Nothing]

I invite you to study the documentation for BioSequence[] and functions related to it in more detail.

That's correct, Samikshaa!

You've got it!

Do you see a path forward to update your code to produce correct output?