Your code is now producing correct output for the central dogma, DNA --> RNA --> Protein.

If you are interested in learning more about bioinformatic topics, let me recommend this book, which is advanced - but there is nothing wrong with challenging yourself.

bioinformatics algorithms

That's correct, Samikshaa!

You've got it!

Do you see a path forward to update your code to produce correct output?

So does that mean the sequence gets reversed before it's translated in mRNA? So then a CAT on the template strand would be 5' - CAT - 3', so the mRNA is 3' - GUA - 5', which then is read by the ribosome as 5' - AUG - 3' and will thus insert a methionine, right?

Well, once you have the BioSequence[], it isn't overly difficult to get the same result as your function:

Lookup[EntityValue[Entity["BioSequenceType", "Peptide"], 
                   EntityProperty["BioSequenceType", "AlphabetRules"]], 
       Characters[BioSequenceTranslate[BioSequenceComplement[
                  BioSequence["DNA", "AGTCGTAGTACGGAT"]]] @ "SequenceString"],
        Nothing]

I invite you to study the documentation for BioSequence[] and functions related to it in more detail.

You are mistaken about the meaning of "coding strand." In the bioinformatics community coding strand refers to the DNA sequence that matches the mRNA (except for having Ts instead of Us). This means the coding strand is what is produced by the process of transcription, and the coding strand (in RNA form) is the template the ribosome would use to make a polypeptide.

See here: coding strand from wikipedia

In essence the coding strand contains the actual codons, so when a ribosome "sees" TAC in the coding strand which is the template the ribosome is attached to, it will insert a tyrosine. The cell does not take the TAC from the coding strand and transcribe it to AUG as you suggest because the coding strand had already been made by transcription.

Think about it and see if you can realize your code is producing incorrect output.

Are you adopting a non-standard genetic code? In the "standard" genetic code "TAC" codes for tyrosine, whereas ATG codes for methionine.

Samikshaa,

I always enjoy seeing Mathematica used for biology topics. Thank you for posting your work.

I do believe that the output of your code is, however, biologically incorrect.

Compare the list of amino acids from your first input cell to the list of amino acids returned by the built-in command BioSequenceTranslate:

ResourceFunction[
ResourceObject[<|"Name" -> "DNAtoAminoAcid", 
"ShortName" -> "DNAtoAminoAcid", 
"UUID" -> "67954e72-53c2-4527-a7c0-68dd2ba1497e", 
"ResourceType" -> "Function", "Version" -> "1.0.0", 
"Description" -> "Convert a given strand of DNA to a list of \
amino acids", 
"RepositoryLocation" -> URL[
"https://www.wolframcloud.com/obj/resourcesystem/api/1.0"], 
"SymbolName" -> "FunctionRepository`$\
093e0005691b471995f708959efa4269`DNAtoAminoAcid", 
"FunctionLocation" -> CloudObject[
"https://www.wolframcloud.com/obj/e7ed59a3-2a4e-4af8-b48c-\
a1d06c90942e"]|>, \
{ResourceSystemBase -> "https://www.wolframcloud.com/obj/\
resourcesystem/api/1.0"}]][\
"GTATACTGGTCATAGCATTGACTGGTCCATGTACTTACCGCT"]

Out[10]= {Entity["Chemical", "LMethionine"], 
Entity["Chemical", "LThreonine"], Entity["Chemical", "LSerine"], 
Entity["Chemical", "LIsoleucine"], Entity["Chemical", "LValine"], 
Entity["Chemical", "LThreonine"], 
Entity["Chemical", "LAsparticAcid"], 
Entity["Chemical", "LGlutamine"], Entity["Chemical", "LValine"], 
Entity["Chemical", "LHistidine"], 
Entity["Chemical", "LGlutamicAcid"], 
Entity["Chemical", "LTryptophan"], Entity["Chemical", "LArginine"]}

In[11]:= BioSequenceTranslate[
BioSequence["DNA", 
"GTATACTGGTCATAGCATTGACTGGTCCATGTACTTACCGCT"]]["SequenceString"]

Out[11]= "VYWS.H.LVHVLTA"

Compare Out[10] to Out[11], they are different.

The codon "GTA" codes for valine, not methionine.

Is this what you intended?

It's similar to those functions, except this is one function and it returns a list of amino acid entities rather than a BioSequence. But those functions are certainly useful!

-- you have earned Featured Contributor Badge Your exceptional post has been selected for our editorial column Staff Picks http://wolfr.am/StaffPicks and Your Profile is now distinguished by a Featured Contributor Badge and is displayed on the Featured Contributor Board. Thank you!